Improbizer Results

Improbizer will display the results in parts. First it will display the profiles (consensus sequences with the probability of each base at each position) individually as they are calculated. The position of a profile in a sequence is indicated by upper case. The strength of the profile match is indicated by the score on the left. There will be a delay during this phase as each profile is calculated. Second Improbizer will display all profiles at once over each sequence. Each profile has it's own color and the stronger the profile matches the darker it will appear in the sequence. Finally there will be a graphic summary of all the profiles at the end, using the same color conventions.

Looking for 4 motifs in 2 sequences. Longest sequence is 150 bases.

Settings are use location; don't include reverse complement; 1 occurrences per sequence; right align; restrain expansionist tendencies 6.000000; number of sequences in initial scan 1000; background model m2; background data fa/mm2.control.gold.up.fa;

12.8602 @ 121.00 sd 1.00 CCCACTA
	a  0.003 0.003 0.003 0.990 0.003 0.003 0.497 
	c  0.990 0.990 0.990 0.003 0.990 0.003 0.003 
	g  0.003 0.003 0.003 0.003 0.003 0.497 0.497 
	t  0.003 0.003 0.003 0.003 0.003 0.497 0.003 
12.42 G6937984@J914178@j_at.+.chr11:101825836-101825986   gatttccctttattgtgtgctaaggaagagtgcctccgacacagtgtcccgttaaccactcctcccccaaatagtcagaaatgcatgttcatagcttgtgaccgtgtgtgtggcacggcttCCCACTAagtgtgaatttgtgttttcaag
13.30 G6962649@J929579_RC@j_at.-.chr2:131276670-131276820 gggcaggcccttgacccccacacctgctcacttccttccattctttctccactgcactgtatctttcttggtctccatctcatcatgctgtcccatctccttcatgggctctctcttcttcCCCACGGcttttgctgttggtggctgtag
12.5210 @ 32.50 sd 1.00 CCTTCCA
	a  0.003 0.003 0.003 0.003 0.003 0.003 0.990 
	c  0.990 0.990 0.003 0.497 0.990 0.497 0.003 
	g  0.003 0.003 0.003 0.003 0.003 0.497 0.003 
	t  0.003 0.003 0.990 0.497 0.003 0.003 0.003 
13.57 G6937984@J914178@j_at.+.chr11:101825836-101825986   gatttccctttattgtgtgctaaggaagagtgCCTCCGAcacagtgtcccgttaaccactcctcccccaaatagtcagaaatgcatgttcatagcttgtgaccgtgtgtgtggcacggcttcccactaagtgtgaatttgtgttttcaag
11.47 G6962649@J929579_RC@j_at.-.chr2:131276670-131276820 gggcaggcccttgacccccacacctgctcacttCCTTCCAttctttctccactgcactgtatctttcttggtctccatctcatcatgctgtcccatctccttcatgggctctctcttcttccccacggcttttgctgttggtggctgtag
11.0684 @ 51.50 sd 3.50 CCACTCC
	a  0.003 0.003 0.990 0.003 0.003 0.003 0.003 
	c  0.990 0.990 0.003 0.990 0.003 0.497 0.990 
	g  0.003 0.003 0.003 0.003 0.003 0.497 0.003 
	t  0.003 0.003 0.003 0.003 0.990 0.003 0.003 
11.24 G6937984@J914178@j_at.+.chr11:101825836-101825986   gatttccctttattgtgtgctaaggaagagtgcctccgacacagtgtcccgttaaCCACTCCtcccccaaatagtcagaaatgcatgttcatagcttgtgaccgtgtgtgtggcacggcttcccactaagtgtgaatttgtgttttcaag
10.89 G6962649@J929579_RC@j_at.-.chr2:131276670-131276820 gggcaggcccttgacccccacacctgctcacttccttccattctttctCCACTGCactgtatctttcttggtctccatctcatcatgctgtcccatctccttcatgggctctctcttcttccccacggcttttgctgttggtggctgtag
10.2368 @ 93.50 sd 6.50 TTCATAG
	a  0.003 0.003 0.003 0.990 0.003 0.497 0.003 
	c  0.003 0.003 0.990 0.003 0.003 0.003 0.003 
	g  0.003 0.003 0.003 0.003 0.003 0.497 0.990 
	t  0.990 0.990 0.003 0.003 0.990 0.003 0.003 
10.39 G6937984@J914178@j_at.+.chr11:101825836-101825986   gatttccctttattgtgtgctaaggaagagtgcctccgacacagtgtcccgttaaccactcctcccccaaatagtcagaaatgcatgTTCATAGcttgtgaccgtgtgtgtggcacggcttcccactaagtgtgaatttgtgttttcaag
10.08 G6962649@J929579_RC@j_at.-.chr2:131276670-131276820 gggcaggcccttgacccccacacctgctcacttccttccattctttctccactgcactgtatctttcttggtctccatctcatcatgctgtcccatctccTTCATGGgctctctcttcttccccacggcttttgctgttggtggctgtag
Color Coding for Profiles
12.8602 @ 121.00 sd 1.00 CCCACTA
	a  0.003 0.003 0.003 0.990 0.003 0.003 0.497 
	c  0.990 0.990 0.990 0.003 0.990 0.003 0.003 
	g  0.003 0.003 0.003 0.003 0.003 0.497 0.497 
	t  0.003 0.003 0.003 0.003 0.003 0.497 0.003 
12.5210 @ 32.50 sd 1.00 CCTTCCA
	a  0.003 0.003 0.003 0.003 0.003 0.003 0.990 
	c  0.990 0.990 0.003 0.497 0.990 0.497 0.003 
	g  0.003 0.003 0.003 0.003 0.003 0.497 0.003 
	t  0.003 0.003 0.990 0.497 0.003 0.003 0.003 
11.0684 @ 51.50 sd 3.50 CCACTCC
	a  0.003 0.003 0.990 0.003 0.003 0.003 0.003 
	c  0.990 0.990 0.003 0.990 0.003 0.497 0.990 
	g  0.003 0.003 0.003 0.003 0.003 0.497 0.003 
	t  0.003 0.003 0.003 0.003 0.990 0.003 0.003 
10.2368 @ 93.50 sd 6.50 TTCATAG
	a  0.003 0.003 0.003 0.990 0.003 0.497 0.003 
	c  0.003 0.003 0.990 0.003 0.003 0.003 0.003 
	g  0.003 0.003 0.003 0.003 0.003 0.497 0.990 
	t  0.990 0.990 0.003 0.003 0.990 0.003 0.003 
Colored Text View of Profiles
Different colors represent different profiles. Darker colors
represent stronger matches to profile.

G6937984@J914178@j_at.+.chr11:101825836-101825986   gatttccctttattgtgtgctaaggaagagtgcctccgacacagtgtcccgttaaccactcctcccccaaatagtcagaaatgcatgttcatagcttgtgaccgtgtgtgtggcacggcttcccactaagtgtgaatttgtgttttcaag
G6962649@J929579_RC@j_at.-.chr2:131276670-131276820 gggcaggcccttgacccccacacctgctcacttccttccattctttctccactgcactgtatctttcttggtctccatctcatcatgctgtcccatctccttcatgggctctctcttcttccccacggcttttgctgttggtggctgtag
Graphical Summary of Profile Hits
Colors represent different profiles. Darker colors represent
stronger matches to profile.