Improbizer Results

Improbizer will display the results in parts. First it will display the profiles (consensus sequences with the probability of each base at each position) individually as they are calculated. The position of a profile in a sequence is indicated by upper case. The strength of the profile match is indicated by the score on the left. There will be a delay during this phase as each profile is calculated. Second Improbizer will display all profiles at once over each sequence. Each profile has it's own color and the stronger the profile matches the darker it will appear in the sequence. Finally there will be a graphic summary of all the profiles at the end, using the same color conventions.

Looking for 4 motifs in 2 sequences. Longest sequence is 150 bases.

Settings are use location; don't include reverse complement; 1 occurrences per sequence; right align; restrain expansionist tendencies 6.000000; number of sequences in initial scan 1000; background model m2; background data fa/mm2.control.gold.up.fa;



12.8602 @ 121.00 sd 1.00 CCCACTA a 0.003 0.003 0.003 0.990 0.003 0.003 0.497 c 0.990 0.990 0.990 0.003 0.990 0.003 0.003 g 0.003 0.003 0.003 0.003 0.003 0.497 0.497 t 0.003 0.003 0.003 0.003 0.003 0.497 0.003


12.42 G6937984@J914178@j_at.+.chr11:101825836-101825986 gatttccctttattgtgtgctaaggaagagtgcctccgacacagtgtcccgttaaccactcctcccccaaatagtcagaaatgcatgttcatagcttgtgaccgtgtgtgtggcacggcttCCCACTAagtgtgaatttgtgttttcaag 13.30 G6962649@J929579_RC@j_at.-.chr2:131276670-131276820 gggcaggcccttgacccccacacctgctcacttccttccattctttctccactgcactgtatctttcttggtctccatctcatcatgctgtcccatctccttcatgggctctctcttcttcCCCACGGcttttgctgttggtggctgtag



12.5210 @ 32.50 sd 1.00 CCTTCCA a 0.003 0.003 0.003 0.003 0.003 0.003 0.990 c 0.990 0.990 0.003 0.497 0.990 0.497 0.003 g 0.003 0.003 0.003 0.003 0.003 0.497 0.003 t 0.003 0.003 0.990 0.497 0.003 0.003 0.003


13.57 G6937984@J914178@j_at.+.chr11:101825836-101825986 gatttccctttattgtgtgctaaggaagagtgCCTCCGAcacagtgtcccgttaaccactcctcccccaaatagtcagaaatgcatgttcatagcttgtgaccgtgtgtgtggcacggcttcccactaagtgtgaatttgtgttttcaag 11.47 G6962649@J929579_RC@j_at.-.chr2:131276670-131276820 gggcaggcccttgacccccacacctgctcacttCCTTCCAttctttctccactgcactgtatctttcttggtctccatctcatcatgctgtcccatctccttcatgggctctctcttcttccccacggcttttgctgttggtggctgtag



11.0684 @ 51.50 sd 3.50 CCACTCC a 0.003 0.003 0.990 0.003 0.003 0.003 0.003 c 0.990 0.990 0.003 0.990 0.003 0.497 0.990 g 0.003 0.003 0.003 0.003 0.003 0.497 0.003 t 0.003 0.003 0.003 0.003 0.990 0.003 0.003


11.24 G6937984@J914178@j_at.+.chr11:101825836-101825986 gatttccctttattgtgtgctaaggaagagtgcctccgacacagtgtcccgttaaCCACTCCtcccccaaatagtcagaaatgcatgttcatagcttgtgaccgtgtgtgtggcacggcttcccactaagtgtgaatttgtgttttcaag 10.89 G6962649@J929579_RC@j_at.-.chr2:131276670-131276820 gggcaggcccttgacccccacacctgctcacttccttccattctttctCCACTGCactgtatctttcttggtctccatctcatcatgctgtcccatctccttcatgggctctctcttcttccccacggcttttgctgttggtggctgtag



10.2368 @ 93.50 sd 6.50 TTCATAG a 0.003 0.003 0.003 0.990 0.003 0.497 0.003 c 0.003 0.003 0.990 0.003 0.003 0.003 0.003 g 0.003 0.003 0.003 0.003 0.003 0.497 0.990 t 0.990 0.990 0.003 0.003 0.990 0.003 0.003


10.39 G6937984@J914178@j_at.+.chr11:101825836-101825986 gatttccctttattgtgtgctaaggaagagtgcctccgacacagtgtcccgttaaccactcctcccccaaatagtcagaaatgcatgTTCATAGcttgtgaccgtgtgtgtggcacggcttcccactaagtgtgaatttgtgttttcaag 10.08 G6962649@J929579_RC@j_at.-.chr2:131276670-131276820 gggcaggcccttgacccccacacctgctcacttccttccattctttctccactgcactgtatctttcttggtctccatctcatcatgctgtcccatctccTTCATGGgctctctcttcttccccacggcttttgctgttggtggctgtag


Color Coding for Profiles

12.8602 @ 121.00 sd 1.00 CCCACTA a 0.003 0.003 0.003 0.990 0.003 0.003 0.497 c 0.990 0.990 0.990 0.003 0.990 0.003 0.003 g 0.003 0.003 0.003 0.003 0.003 0.497 0.497 t 0.003 0.003 0.003 0.003 0.003 0.497 0.003 12.5210 @ 32.50 sd 1.00 CCTTCCA a 0.003 0.003 0.003 0.003 0.003 0.003 0.990 c 0.990 0.990 0.003 0.497 0.990 0.497 0.003 g 0.003 0.003 0.003 0.003 0.003 0.497 0.003 t 0.003 0.003 0.990 0.497 0.003 0.003 0.003 11.0684 @ 51.50 sd 3.50 CCACTCC a 0.003 0.003 0.990 0.003 0.003 0.003 0.003 c 0.990 0.990 0.003 0.990 0.003 0.497 0.990 g 0.003 0.003 0.003 0.003 0.003 0.497 0.003 t 0.003 0.003 0.003 0.003 0.990 0.003 0.003 10.2368 @ 93.50 sd 6.50 TTCATAG a 0.003 0.003 0.003 0.990 0.003 0.497 0.003 c 0.003 0.003 0.990 0.003 0.003 0.003 0.003 g 0.003 0.003 0.003 0.003 0.003 0.497 0.990 t 0.990 0.990 0.003 0.003 0.990 0.003 0.003


Colored Text View of Profiles

Different colors represent different profiles. Darker colors represent stronger matches to profile. G6937984@J914178@j_at.+.chr11:101825836-101825986
gatttccctttattgtgtgctaaggaagagtgcctccgacacagtgtcccgttaaccactcctcccccaaatagtcagaaatgcatgttcatagcttgtgaccgtgtgtgtggcacggcttcccactaagtgtgaatttgtgttttcaag G6962649@J929579_RC@j_at.-.chr2:131276670-131276820 gggcaggcccttgacccccacacctgctcacttccttccattctttctccactgcactgtatctttcttggtctccatctcatcatgctgtcccatctccttcatgggctctctcttcttccccacggcttttgctgttggtggctgtag


Graphical Summary of Profile Hits

Colors represent different profiles. Darker colors represent stronger matches to profile.


Calculation time was 0.109 minutes