Supplementary Figures and Tables for

Burckin et al.

Nature Structural and Molecular Biology 2005

 

Figures:

 

Supplementary Figure 1. Comparison of microarray results with quantitative polymerase chain reaction (QPCR).  A scatter plot of the log2 ratio from microarrays verses ratios calculated from QPCR measurements for 13 targets in seven different mutants. A table of microarray and QPCR values for each primer set in each mutant are provided in Supplementary Table 1.  Key: mex67-6 (light blue), spt6-14 (pink), rrp6D (red), prp11-1 (green) prp19-1 (orange), prp20-1 (brown), ded1-120 (dark blue).

 

Supplementary Figure 2. A plot of intron vs. exon log2 ratios reveals distinct transcript accumulation phenotypes.  A plot of the log2 ratio for the exon feature of an mRNA against the log2 ratio for the intron signal from the same gene is shown.  X coordinate values are exon log ratios and Y coordinates are intron log ratios for the corresponding mRNA feature. The values for three unique yeast mutations are shown: dbr1, an intron decay mutant, (green); prp4-1, a splicing mutant, (orange); and rbp1-1, a transcription mutant (blue).

 

Supplementary Figure 3. The ceg1-250 mutation causes widespread intron accumulation.  A plot of the log2 ratio for the exon feature of an mRNA against the log2 ratio for the intron signal from the same gene is shown.  X coordinate values are exon log ratios and Y coordinates are intron log ratios for the corresponding mRNA feature. The values for the ceg1-250 and prp4-1 mutations are shown: ceg1-250, an mRNA capping mutant, (purple); prp4-1, a splicing mutant, (orange).

 

Supplementary Figure 4.  ROC plots for the individual classifiers of the multi-class SVM.  See methods for explanation of ROC curve.

 

Tables:

Supplementary Table 1. Values for individual points represented in Supplementary Figure 1.

 

mex67-6

 

spt6-14

 

rrp6D

 

prp11-1

 

prp19-1

 

prp20-1

 

ded1-120

 

Gene

QPCR

array

QPCR

array

QPCR

array

QPCR

array

QPCR

array

QPCR

array

QPCR

array

YRA1 EX2

0.525

1.500

-0.175

-0.954

1.025

0.710

-0.575

-0.580

0.925

1.230

2.825

2.090

-0.833

-0.050

RPL39 INT

0.725

-0.470

1.125

-0.830

2.075

0.460

1.100

0.880

2.250

1.660

2.275

1.090

2.400

1.540

RPL39 EX2

-0.700

-1.190

-1.075

-1.590

0.300

0.490

-1.500

-0.930

-1.400

-0.360

0.700

1.060

0.433

0.840

RPS13 INT

1.050

0.460

1.175

0.290

2.750

0.952

-0.100

0.230

-0.700

0.830

0.475

0.760

1.800

1.540

RPS13 EX2

-1.375

-1.600

-1.525

-1.620

-0.675

0.163

-1.850

-1.500

-1.300

-0.270

0.150

-0.270

0.233

0.560

RPL30 INT

1.025

0.220

0.100

-0.710

1.150

1.240

0.050

0.200

-0.400

0.540

-0.400

1.110

2.300

1.880

PBN1

-0.475

0.140

0.250

0.035

0.450

-0.180

-0.675

-0.081

0.225

0.330

0.400

-0.070

-0.400

0.000

RPS2

-1.500

-1.560

-1.550

-1.700

-1.050

-0.450

-0.750

-0.600

-1.525

-0.570

-0.200

-0.398

0.100

0.450

U2 snRNA

2.725

1.940

2.075

1.710

0.650

0.634

0.800

0.439

4.008

2.479

3.000

1.795

-1.225

0.320

U4 snRNA

2.075

1.580

n/a

n/a

5.700

2.850

-0.825

-0.506

0.450

0.553

1.200

0.510

-0.550

-0.090

U5 snRNA

2.250

1.660

3.075

1.520

4.475

2.510

-0.725

-0.182

1.675

1.711

0.750

1.459

-1.350

-0.430

U6 snRNA

2.150

1.980

3.650

1.460

8.925

4.570

n/a

n/a

-0.775

0.714

0.050

0.934

-1.625

-0.090

pre-EFB1

1.075

1.580

2.350

1.680

6.575

1.350

2.200

0.058

2.975

3.300

n/a

n/a

-0.500

0.080

 

 

Supplementary Table 2. Oligonucleotides used for QPCR analysis.

Gene

Name

Target

Forward oligo (5-3)

Reverse oligo (5-3)

YRA1

YDR381W

Exon 2

GTAGGTGGTGTTCAAAGAGT

ATTGGAGAGCCCGTTAAA

RPL39

YJL189W

Intron

TTCGTATGTGCACGATATG

CATCTTGGTTCTTCTCCAG

PPL39

YJL189W

Exon 2

AAAGTCTTTCAGAATCAAGCA

CATCTTGGTTCTTCTCCAG

RPS13

YDR064W

Intron

ATTCCACTAAATATTACTTTAAACAG

GGATTTCTGGAGCCAAA

RPS13

YDR064W

Exon 2

CTGCTATTCCATACTCTAGAAATG

GGATTTCTGGAGCCAAA

RPL30

YGL030W

Intron

TTTATCGTTTACATTTCAAGAG

AATCCCAAGAATCTATCAACC

PBN1

YCL052C

ORF    

CTGCGACACAGGTGACAA

GGTACCATTTTTGATCTTGGA

RPS2

YL123W

ORF    

CCCAAGAGGTTCTGGA

TGGAGAAACTGGCAATG

LSR1

LSR1

U2 snRNA

ATAGTAGGTTGGGAGATAATATTTATGG

GAAGGAGAACGTCGCGGTGGTC

SNR14

SNR14

U4 snRNA

CGCATATCAGTGAGGATTCGTCCGAG

GGGATGTATCAGAACTTC

SNR7

SNR7

U5 snRNA

TTACAGATCAATGGCGGAGGGAGGTC

ACACCCGGATGGTTCTGGTA

SNR6

SNR6

U6 snRNA

GTTCGCGAAGTAACCCTTCGTGGAC

TTGCTTTATTTAGAGAAACATTTTG

EFB1

YAL003W

pre-EFB1

ACAGTATCTGACGATAGCACA

GACGTCAGCTTGAGAAAC

 

Supplementary Table 3. Filtered IA data used to create the cluster of Fig 1.

Supplementary Table 4. SVM scores used for the heat map in Fig. 2.

Supplementary Table 5. Experimental details and strain genotypes.